View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4134_high_19 (Length: 346)
Name: NF4134_high_19
Description: NF4134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4134_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 221
Target Start/End: Original strand, 38887337 - 38887541
Alignment:
| Q |
17 |
agatcaaacaatgctcaagtgatttcacattttcctgtccatgatggtacttctttcattccttgaaagaaaatattgtgatgcatggatccttaattac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38887337 |
agatcaaacaatgctcaagtgatttcacattttcctgtccatgatggtacttctttcattccttgaaagaaaatattgtgatgcatggatccttaattac |
38887436 |
T |
 |
| Q |
117 |
aatttgaagaaataagttaataacaaacagtagtttaagaggggaaaagtaactgcttcatctgaaaactaatggtgagggataagtaaggaaaaaatta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38887437 |
aatttgaagaaataagttaataacaaacagtagtttaagaggggaaaagtaactgcttcatctgaaaactaatggtgagggataagtaaggaaaaaatta |
38887536 |
T |
 |
| Q |
217 |
tacat |
221 |
Q |
| |
|
||||| |
|
|
| T |
38887537 |
tacat |
38887541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 285 - 328
Target Start/End: Original strand, 38887603 - 38887646
Alignment:
| Q |
285 |
gaagtgtagctggtctcatgctttgtacaatgacaccaaaacat |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38887603 |
gaagtgtagctggtctcatgctttgtacaatgacaccaaaacat |
38887646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University