View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4134_high_26 (Length: 279)
Name: NF4134_high_26
Description: NF4134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4134_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 172 - 269
Target Start/End: Original strand, 10054416 - 10054513
Alignment:
| Q |
172 |
atggtgtataaaaatttaatcttttttgtagaatcactttcaagaggatcattgtcaacaaatcaactgaaaaattctctggtgttccttaccctatg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10054416 |
atggtgtataaaaatttaatcttttttgtagaatcacgttcaagaggatcattgtcaacaaatcaactgaaaaattctctggtgttccttaccctatg |
10054513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 42 - 98
Target Start/End: Original strand, 10054286 - 10054342
Alignment:
| Q |
42 |
tgtgatgcaggaaatgcttttggcctttttctcttcttggctccaatgtatagattc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10054286 |
tgtgatgcaggaaatgcttttggcctttttctcttcttggctccaatgtatagattc |
10054342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University