View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4134_high_26 (Length: 279)

Name: NF4134_high_26
Description: NF4134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4134_high_26
NF4134_high_26
[»] chr1 (2 HSPs)
chr1 (172-269)||(10054416-10054513)
chr1 (42-98)||(10054286-10054342)


Alignment Details
Target: chr1 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 172 - 269
Target Start/End: Original strand, 10054416 - 10054513
Alignment:
172 atggtgtataaaaatttaatcttttttgtagaatcactttcaagaggatcattgtcaacaaatcaactgaaaaattctctggtgttccttaccctatg 269  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10054416 atggtgtataaaaatttaatcttttttgtagaatcacgttcaagaggatcattgtcaacaaatcaactgaaaaattctctggtgttccttaccctatg 10054513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 42 - 98
Target Start/End: Original strand, 10054286 - 10054342
Alignment:
42 tgtgatgcaggaaatgcttttggcctttttctcttcttggctccaatgtatagattc 98  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10054286 tgtgatgcaggaaatgcttttggcctttttctcttcttggctccaatgtatagattc 10054342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University