View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4134_high_29 (Length: 248)
Name: NF4134_high_29
Description: NF4134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4134_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 9 - 244
Target Start/End: Complemental strand, 13975691 - 13975458
Alignment:
| Q |
9 |
ataattctgaatggagctttggaattttaaccctaacaacaactattctattcttttgtgcactctnnnnnnnnttggacgtcatctttaaataataaga |
108 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13975691 |
ataattctgaatggagcttttgaattttaaccctaacaacaactattctattcttttgtgcactctaaaaaaaattggacgtcatctttaaataataaga |
13975592 |
T |
 |
| Q |
109 |
taatgatgctaccttgcatggaccatcatagagaacttttgatcatataaacttgacaaatacttgcaacactcatttttgaacactctctttgacatat |
208 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || || |
|
|
| T |
13975591 |
taatgatgcaaccttgcatggaccatcatagagaatttttgatcatataaacttgacaaatacatgcaacactcatttttgaacactctctttaac--at |
13975494 |
T |
 |
| Q |
209 |
tcannnnnnnattggagggaatcgttaaatgtccca |
244 |
Q |
| |
|
||| ||||||||||||||||| |||||||| |
|
|
| T |
13975493 |
tcacttttttattggagggaatcgttacatgtccca |
13975458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University