View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4134_low_28 (Length: 256)
Name: NF4134_low_28
Description: NF4134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4134_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 13975351 - 13975112
Alignment:
| Q |
1 |
tagggcatttggccatttataaactgaaactcattcatgttatttactatttatttttattaattgaatctccctttaatggatttttctttcaagtgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13975351 |
tagggcatttggccatttataaactgaaactcattcatgttatttactatttatttttattaattgaatctccctttaatggatttttctttcaagtgat |
13975252 |
T |
|
| Q |
101 |
atctaaaagacgcacgctctttcttttttgaactttagttaacacaaattccaaacccttttcttctcctagagatgctccctcttttaccctctctttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13975251 |
atctaaaagacgcacgctctttcttttttgaactttagttaacacaaattccaaacccttttcttctcctagagatgctccctcttttaccctctctttc |
13975152 |
T |
|
| Q |
201 |
ataacctttgcagttgcatccacctcttcaatggttttgt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13975151 |
ataacctttgcagttgcatccacctcttctatggttttgt |
13975112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University