View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4134_low_30 (Length: 248)

Name: NF4134_low_30
Description: NF4134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4134_low_30
NF4134_low_30
[»] chr5 (1 HSPs)
chr5 (9-244)||(13975458-13975691)


Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 9 - 244
Target Start/End: Complemental strand, 13975691 - 13975458
Alignment:
9 ataattctgaatggagctttggaattttaaccctaacaacaactattctattcttttgtgcactctnnnnnnnnttggacgtcatctttaaataataaga 108  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||    
13975691 ataattctgaatggagcttttgaattttaaccctaacaacaactattctattcttttgtgcactctaaaaaaaattggacgtcatctttaaataataaga 13975592  T
109 taatgatgctaccttgcatggaccatcatagagaacttttgatcatataaacttgacaaatacttgcaacactcatttttgaacactctctttgacatat 208  Q
    ||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||  ||    
13975591 taatgatgcaaccttgcatggaccatcatagagaatttttgatcatataaacttgacaaatacatgcaacactcatttttgaacactctctttaac--at 13975494  T
209 tcannnnnnnattggagggaatcgttaaatgtccca 244  Q
    |||       ||||||||||||||||| ||||||||    
13975493 tcacttttttattggagggaatcgttacatgtccca 13975458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University