View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4134_low_31 (Length: 247)
Name: NF4134_low_31
Description: NF4134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4134_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 43906290 - 43906522
Alignment:
| Q |
1 |
ttatttatttttggtgattagaagaatgatgcatatttatcggtttcttgtgtaggaaactttcatagaagtctcttannnnnnngtaacaaccacgtgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
43906290 |
ttatttatttttggtgattagaagaatgatgcatatttatcggtttcttgtgtaagaaactttcatagaagtctcttattttttt------------tgt |
43906377 |
T |
|
| Q |
101 |
tctctaacacaaataccctttcattcctttcatttttctttcattctttacgtctttcaatttatagattctggcactgacaaatttcatgaccattcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43906378 |
tctctaacacaaataccctttcattcctttcatttttctttcattctttacgtctttcaatttatagattctggcactgacaaatttcatgaccattcct |
43906477 |
T |
|
| Q |
201 |
ctttttcttttgttccaaaatgtcacatgaatcacctatgcttct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43906478 |
ctttttcttttgttccaaaatgtcacatgaatcacctatgattct |
43906522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University