View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4135_low_11 (Length: 291)
Name: NF4135_low_11
Description: NF4135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4135_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 5758985 - 5759157
Alignment:
| Q |
1 |
tgcgatagtgtagggtactcacataggtgttgagatatagataacaatttttagtacttagttctgttcgaaattatccatgactatcatgaaagatttt |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5758985 |
tgcgatagtgtaggttactcacataggtgttgagatatagataacaatttttagtacttagttctgttcgaaattatccatgactatcatgaaagatttt |
5759084 |
T |
|
| Q |
101 |
ttaatctgtctgattttcctttactgattgttctattctttggaaggagcttttcttcaccctaacatgacacc |
174 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5759085 |
ttaatcggtctgaatttcctttactgattgttctattctttggaaggagc-tttcttcaccctaacatgacacc |
5759157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University