View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4135_low_12 (Length: 282)
Name: NF4135_low_12
Description: NF4135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4135_low_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 51341598 - 51341895
Alignment:
| Q |
1 |
caaatctcagctgcaaatctaatcatatccataaaacaaaatggtaacaattaatatcaacttcaggttgtatattatttaaacaatatgtctattgaga |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |||||| |
|
|
| T |
51341598 |
caaatctcagccacaaatctaatcatatccataaaacaaaatggtaacaattaatatcaacttcaggttgtatattattaagacaatatgtctcttgaga |
51341697 |
T |
 |
| Q |
101 |
ttac----------------aaattcaatcacaatctagtataaatttttcattccaagtaaaaaagaggccagttatagtcaatccccattatggacaa |
184 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51341698 |
ttacaaattcaatcacttacaaattcaatcacaatctagtataaatttttcattccaagtaaaaaagaggccagttatagtcaatccccattatggacaa |
51341797 |
T |
 |
| Q |
185 |
aaccatagctgcacattcttggaaaaagactcgtagcaaacgcgcagcgatgtataaagaataataggaaaagcaaacaaaggcgaaagctggcataa |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51341798 |
aaccatagctgcacattcttggaaaaagactcgtagcaaacgcgcagcgatgtataaagaataataggaaaagcaaacaaaggcgaaggctggcataa |
51341895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University