View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4135_low_17 (Length: 213)
Name: NF4135_low_17
Description: NF4135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4135_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 54 - 176
Target Start/End: Complemental strand, 2653139 - 2653017
Alignment:
| Q |
54 |
aggaaattgaagcaaaatagaaaggtaatattttagcttatgtgatttctccttcctcaacattgtctgtcccattaagtttctgatagttattgttttt |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
2653139 |
aggaaattgaagcaaaatagaaaggtaatattttagcttatgtgacttctccttcctcaacattgtctgtcccatcaagtttttgatagttattgttttt |
2653040 |
T |
|
| Q |
154 |
atttgttagatagaatgctaaaa |
176 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2653039 |
atttgttagatagaatgctaaaa |
2653017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 53
Target Start/End: Complemental strand, 2653191 - 2653156
Alignment:
| Q |
18 |
ggtagtcacacagagtgaaatgtgttttctggtctg |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2653191 |
ggtagtcacacagagtgaaatgtgttttctggtctg |
2653156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 200
Target Start/End: Complemental strand, 1548495 - 1548426
Alignment:
| Q |
130 |
aagtttctgatagttattgtttttatttgttagatagaatgctaaaattgaagttgctcatctctccacag |
200 |
Q |
| |
|
|||||| |||||||||||||| | ||||| || ||||| ||||| |||||||||||||||||||| |||| |
|
|
| T |
1548495 |
aagtttttgatagttattgttctg-tttgtcaggtagaaggctaacattgaagttgctcatctctctacag |
1548426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University