View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4136_low_13 (Length: 309)
Name: NF4136_low_13
Description: NF4136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4136_low_13 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 127 - 309
Target Start/End: Complemental strand, 42209763 - 42209581
Alignment:
| Q |
127 |
gatgttagtagcaccgttaacattacttaatttgggttctgcagcaacatgtgtagatggtaatttccagttcacggggaatgtcaaaatgtcccaccag |
226 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42209763 |
gatgttagtagccccgttaacattacttaatttgggttctgcagcaacatgtgtagatggtaatttccagttcacggggaatgtcaaaatgtcccaccag |
42209664 |
T |
|
| Q |
227 |
gtctactctctatctgtttgcatttactcaagatgccatttcatatcattgctttctgttgtggattagacgtcataaggcaa |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42209663 |
gtctactctctatctgtttgcatttactcaagatgccatttcatatcattgctttctgttgtggattagacgtcataaggcaa |
42209581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 42209886 - 42209835
Alignment:
| Q |
1 |
tatgaaaccccctgatattagcactacatctaccaaaggcaagtcatgacgg |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42209886 |
tatgaaaccccctgatattagcactacatctaccaaaggcaagtcatgacgg |
42209835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University