View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4137_high_5 (Length: 364)

Name: NF4137_high_5
Description: NF4137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4137_high_5
NF4137_high_5
[»] chr6 (1 HSPs)
chr6 (228-350)||(5997859-5997981)


Alignment Details
Target: chr6 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 228 - 350
Target Start/End: Original strand, 5997859 - 5997981
Alignment:
228 aaatttggtattctctgtcttttcttgtcgatggttgcccttagtgttacggtgttccagaactgaagaggcacattggactcactgaagaaaattcttt 327  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
5997859 aaatttggtattctctgtcttttctcgtcgatggttgcccttagtgttacggtgttccagaactgaaggggcacattggactcactgaagaaaattcttt 5997958  T
328 ccttgtttatggccccccttagt 350  Q
    |||||||||||||||||||||||    
5997959 ccttgtttatggccccccttagt 5997981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University