View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4137_low_10 (Length: 256)
Name: NF4137_low_10
Description: NF4137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4137_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 42984754 - 42984508
Alignment:
| Q |
1 |
tgattttgtgaagctaaaaaagcaaatgctgatgttaattatttttgtgatggtttgtagctcccttgcataatgtggatttttatttacaaacccaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42984754 |
tgattttgtgaagctaaaaaagcaaatgctgatgttaattatttttgtgatggtttgtagctcccttgcataatgtggatttttatttacaaacccaagc |
42984655 |
T |
|
| Q |
101 |
tatttagcttgtcttggtgtgcaaattgggtatgtaaactatatt-ttttccaataatggtatatttttgttacttcttattgtatgaatctgacttttc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42984654 |
tatttagcttgtcttggtgtgcaaattgggtatgtaaactatatttttttccaatattggtatatttttgttacttcttattgtatgaatctgacttttc |
42984555 |
T |
|
| Q |
200 |
ttgtaattgtgtcagttttgtattgtattcggagtctcattgatgat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42984554 |
ttgtaattgtgtcagttttgtattgtattcggagtctcattgatgat |
42984508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 54 - 135
Target Start/End: Original strand, 43855341 - 43855422
Alignment:
| Q |
54 |
tttgtagctcccttgcataatgtggatttttatttacaaacccaagctatttagcttgtcttggtgtgcaaattgggtatgt |
135 |
Q |
| |
|
||||||||| |||||||| |||||| || |||||||||||| ||| |||||||||||||||| | |||||||||||| |
|
|
| T |
43855341 |
tttgtagcttccttgcattatgtggcttgctatttacaaacctaagaggtttagcttgtcttggttcaccaattgggtatgt |
43855422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University