View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4137_low_11 (Length: 250)
Name: NF4137_low_11
Description: NF4137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4137_low_11 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 13 - 148
Target Start/End: Original strand, 47904731 - 47904866
Alignment:
| Q |
13 |
attctgtttggaatcttatcgttttctggtagaatccgttttggatctggattgtggggtgaataggataaatatccttgtcattctcttctatcttctc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47904731 |
attctgtttggaatcttatcgttttctggtagaatccgttttggatccggattgtagggtgaataggataaatatccttgtcattctcttctatcttctc |
47904830 |
T |
|
| Q |
113 |
ggattatcttttgcatcctctaattggtttttaact |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
47904831 |
agattatcttttgcatcctctaattggtttttaact |
47904866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 185 - 246
Target Start/End: Original strand, 47904887 - 47904948
Alignment:
| Q |
185 |
cagacaaaacctacataattcaacccccttgtgtttttctcacctttaacatgttatgggcc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47904887 |
cagacaaaacctacataattcaacccccttgtgtttttcttacctttaacatgttatgggcc |
47904948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 196 - 230
Target Start/End: Original strand, 18821355 - 18821389
Alignment:
| Q |
196 |
tacataattcaacccccttgtgtttttctcacctt |
230 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
18821355 |
tacacaattcaacccccttgtgtttttctcacctt |
18821389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 148
Target Start/End: Original strand, 260544 - 260596
Alignment:
| Q |
96 |
ttctcttctatcttctcggattatcttttgcatcctctaattggtttttaact |
148 |
Q |
| |
|
||||||||| |||||| | |||||||||||||||||||| || ||||||||| |
|
|
| T |
260544 |
ttctcttcttccttctccggttatcttttgcatcctctaactgatttttaact |
260596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University