View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4137_low_13 (Length: 243)
Name: NF4137_low_13
Description: NF4137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4137_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 75 - 219
Target Start/End: Complemental strand, 30529711 - 30529567
Alignment:
| Q |
75 |
aaatataacaacctcattcttgannnnnnncccaaaattcttttagaaagccaaaattaacttcatcggacctaaaattcttaaatctatcacaatccta |
174 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
30529711 |
aaatataacaacctcattcttgatttctt-cccaaaattcttttagaaagccaaaattaacttcatcggacctaaagttcttaaatctgtcacaatccta |
30529613 |
T |
 |
| Q |
175 |
-nnnnnnnncttcaaacttttgctaatttctataatagaattggct |
219 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30529612 |
tttttttttcttcaaacttttgctaatttcaataatagaattggct |
30529567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University