View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4137_low_14 (Length: 236)
Name: NF4137_low_14
Description: NF4137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4137_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 42984742 - 42984963
Alignment:
| Q |
1 |
cttcacaaaatcacagggccgacgtgattttgttaaactcaccattgatctaaacatgcaagatattttacttttcttacaaaatatgtggttggagcaa |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42984742 |
cttcacaaaatcacagggccgccgtgattttgttaaactcaccattgatctaaacatgcaagatattttacttttcttacaaaatatgtggttggagcaa |
42984841 |
T |
 |
| Q |
101 |
atacaaatcccccaaaaaagctgagaagcccaccaaagaaaggaaatgtaattgcaaggaccatggtaattgctgcatataagtaattgttaaattaaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42984842 |
atacaaatcccccaaaaaagctgagaagcccaccaaagaaaggaaatgtaattgcaaggaccatggtaattgctgcatataagaaattgttaaattaaaa |
42984941 |
T |
 |
| Q |
201 |
ttctctatgtaaatgaaattta |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42984942 |
ttctctatgtaaatgaaattta |
42984963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 10810950 - 10810894
Alignment:
| Q |
1 |
cttcacaaaatcacagggccgacgtgattttgttaaactcaccattgatctaaacat |
57 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||||||||| || |||||||||| |
|
|
| T |
10810950 |
cttcacaaaatcacaatgccatcgtgattttgctaaactcaccgttaatctaaacat |
10810894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University