View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4137_low_8 (Length: 309)
Name: NF4137_low_8
Description: NF4137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4137_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 19 - 285
Target Start/End: Complemental strand, 47905367 - 47905102
Alignment:
| Q |
19 |
ataatgcatatatgaaatgatgtaaaacctgtgtcataattatttgttttgttatagtgaaagaaccatagacatcatgcacaccatgcatacaaaaaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47905367 |
ataatgcatatatgaaatgatgtaaaacctgtgtcataatt---tgttttgttatagtgaaagaaccatagacatcatgcacaccatgcatacaaaaaat |
47905271 |
T |
|
| Q |
119 |
atgacat--tgttccatgacattatatcattcatcataccaacaacttcatcctgattttgcagccttgcctctgttttgtatgttccaaacataacatt |
216 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
47905270 |
atgacatattgttccatgactttatatcattcatcataccaacaacttcatcctgactttgcaacctcgcctctgttttccatgttccaaacataacatc |
47905171 |
T |
|
| Q |
217 |
atgaaacacatgaaccattttcttaccttcctgcatcttcatgaaacacaaaaatccaatttgtttccc |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47905170 |
atgaaacacatgaaccattttcttaccttcctgcatcttcatgaaacacaaaaatccaatttgtttccc |
47905102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University