View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4138_high_2 (Length: 291)
Name: NF4138_high_2
Description: NF4138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4138_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 279
Target Start/End: Original strand, 41957931 - 41958201
Alignment:
| Q |
18 |
aagaaaagtgaaagtcaaaatctatacctagagctagaggtgtttatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41957931 |
aagaaaagtgaaagtcaaaatctatacctagagctagaggtgttcatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttg |
41958030 |
T |
 |
| Q |
118 |
tcggataacggatttgtcggttgaaactcacaaatgca--------acatctcatgcagtattactttcggttcgctttgcgctaatgttctaccttt-t |
208 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41958031 |
tcacataacggatttgtcggttgaaactcacaaatgcaacccgttgacatctcatgcagtattactttcggttcgctttgcgctaatgttctacctttct |
41958130 |
T |
 |
| Q |
209 |
ttgtcttgggattttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgctctg |
279 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||| |||||||| ||||||| |||||||||||| |
|
|
| T |
41958131 |
ctgtcttcggattttggcatcgggttatattgatgggttggatttttggacaggttaaggtgtctgctctg |
41958201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 18 - 181
Target Start/End: Original strand, 5599003 - 5599164
Alignment:
| Q |
18 |
aagaaaagtgaaagtcaaaatctatacctagagctagaggtgtttatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5599003 |
aagaaaagtgaaagtcaaaatctatacctagagctagaggtgttcatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttg |
5599102 |
T |
 |
| Q |
118 |
tcggataacggatttgtcggttgaaactcacaaatgca--------acatctcatgcagtattactttcggt |
181 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5599103 |
tc----------tttgtcggttgaaactcacaaatgcaaccagttgacatctcatgcagtattactttcggt |
5599164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 49 - 119
Target Start/End: Complemental strand, 5597558 - 5597488
Alignment:
| Q |
49 |
agctagaggtgtttatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttgtc |
119 |
Q |
| |
|
||||||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
5597558 |
agctagaggtgttcatgtgtacgggtcaaatatgaacacagttgcacaaacgacccaaaccgacatttgtc |
5597488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 18 - 181
Target Start/End: Original strand, 25548924 - 25549085
Alignment:
| Q |
18 |
aagaaaagtgaaagtcaaaatctatacctagagctagaggtgtttatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25548924 |
aagaaaagtgaaagtcaaaatctatacctagagctagaggtgttcatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaatcggcatttg |
25549023 |
T |
 |
| Q |
118 |
tcggataacggatttgtcggttgaaactcacaaatgca--------acatctcatgcagtattactttcggt |
181 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25549024 |
tc----------tttgtcggttgaaactcacaaatgcaacccgttgacatctcatgcagtattactttcggt |
25549085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 18 - 157
Target Start/End: Original strand, 40637246 - 40637375
Alignment:
| Q |
18 |
aagaaaagtgaaagtcaaaatctatacctagagctagaggtgtttatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttg |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40637246 |
aagaaaagtgaaagtcaaaatttatacctagagctagaggtgttcatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccgtcatttg |
40637345 |
T |
 |
| Q |
118 |
tcggataacggatttgtcggttgaaactcacaaatgcaac |
157 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |
|
|
| T |
40637346 |
tc----------tttgtcggttgaaactcacaaatgcaac |
40637375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 49 - 119
Target Start/End: Complemental strand, 40635808 - 40635738
Alignment:
| Q |
49 |
agctagaggtgtttatgtgtacgggtcaactgtgaacccagttgcacaaacgacccaaaccggcatttgtc |
119 |
Q |
| |
|
||||||||||||| ||||||||||||||| | ||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
40635808 |
agctagaggtgttcatgtgtacgggtcaaatatgaacacagttgcacaaacgacccaaaccgacatttgtc |
40635738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 179 - 277
Target Start/End: Original strand, 1799014 - 1799112
Alignment:
| Q |
179 |
ggttcgctttgcgctaatgttctacctttttt--gtcttgggattttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgct |
276 |
Q |
| |
|
||||| |||||||||| |||||| |||||| | ||||| ||||||||||||| |||||| || ||||| | ||||||||||||||||| ||||||||| |
|
|
| T |
1799014 |
ggttcactttgcgctattgttctgccttttctctgtctttggattttggcatcgggttat--tggtgggtcgagtttttggataggttaaggtgtctgct |
1799111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 279
Target Start/End: Original strand, 35846965 - 35847065
Alignment:
| Q |
179 |
ggttcgctttgcgctaatgttctacctttt--ttgtcttgggattttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgct |
276 |
Q |
| |
|
|||||||||| |||| ||||| ||||||| ||||||| ||||||||||||| ||| ||||| ||||| ||||||||| | ||||| ||||||||| |
|
|
| T |
35846965 |
ggttcgctttatgctattgttccaccttttctttgtctttggattttggcatcgggt--tattggtgggtcaagtttttggacatgttaaggtgtctgct |
35847062 |
T |
 |
| Q |
277 |
ctg |
279 |
Q |
| |
|
||| |
|
|
| T |
35847063 |
ctg |
35847065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 279
Target Start/End: Original strand, 45181462 - 45181562
Alignment:
| Q |
179 |
ggttcgctttgcgctaatgttctacctttttt--gtcttgggattttggcatctggttatattgatgggttgggtttttggataggttaaagtgtctgct |
276 |
Q |
| |
|
|||||| ||||||||| | ||| ||||||||| ||||| |||||||||||| |||||| || ||||| | ||||||||| |||||| ||||||||| |
|
|
| T |
45181462 |
ggttcgttttgcgctactattccaccttttttctgtctttggattttggcattgggttat--tggtgggtcgagtttttggacaggttagggtgtctgct |
45181559 |
T |
 |
| Q |
277 |
ctg |
279 |
Q |
| |
|
||| |
|
|
| T |
45181560 |
ctg |
45181562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University