View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4138_low_2 (Length: 365)
Name: NF4138_low_2
Description: NF4138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4138_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 4e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 16 - 160
Target Start/End: Complemental strand, 25609956 - 25609813
Alignment:
| Q |
16 |
ctgaggtgtaatcacttccattatctaatcttaacatttgaattttgcattcacactgattttcaacccaaatatttgaattaacagaaatatcagcaac |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
25609956 |
ctgaggtgtattcacttccattatctaatcttaacatttgaattttgcattcacactgattttcaacccaaa-atttgaattaacaaaaatatcagcaac |
25609858 |
T |
 |
| Q |
116 |
ttcaaattttaatttcatccagcatacccttgtaaaatcatctat |
160 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25609857 |
gtcaaatgttaatttcaatcagcatacccttgtaaaatcatctat |
25609813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 164 - 244
Target Start/End: Complemental strand, 25609679 - 25609599
Alignment:
| Q |
164 |
agcttctcatattgtaacaagtctaatgaaaaacttttaaccttcataggtatagtaaacaactctgtggcatcagaagat |
244 |
Q |
| |
|
|||||||| | |||||||||||||||| ||||||||||||||||||| ||| || | || |||||||||||||||| |||| |
|
|
| T |
25609679 |
agcttctcgttttgtaacaagtctaataaaaaacttttaaccttcattggtttactgaagaactctgtggcatcagcagat |
25609599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University