View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4140_low_13 (Length: 245)
Name: NF4140_low_13
Description: NF4140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4140_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 19 - 217
Target Start/End: Original strand, 17066030 - 17066228
Alignment:
| Q |
19 |
attctctcttttgtacttgtattgttaacatgatatctcgagcttgtttcgatccgtcttaaaggagataactgt-gagtgatctcacacgcatcggcct |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
17066030 |
attctctcttttgtacttgtattgtcaacatgatatctcgagcttgtttcgatccgt-ttaaaggagataactgtcgagtgatctcacacacatcggcct |
17066128 |
T |
|
| Q |
118 |
ctcaagcattttctcaacactctagttttgaatctagtcttggtgtttggttttgatgcatgaatacctagattctgttatggtgacttctattcccacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17066129 |
ctcaagcattttctcaacactctagttttgaatctagtcttggtgtttggttttgatgcatgaatacctagattatgttatggtgacttctattcccacc |
17066228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 210 - 245
Target Start/End: Original strand, 17066287 - 17066322
Alignment:
| Q |
210 |
ttcccaccaacgatgatcagtcctgacttctaatcc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
17066287 |
ttcccaccaacgatgatcagtcctgacttctaatcc |
17066322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 24131919 - 24131973
Alignment:
| Q |
19 |
attctctcttttgtacttgtattgttaacatgatatctcgagcttgtttcgatcc |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||| ||||| |
|
|
| T |
24131919 |
attctctcttttgtacttgtattgttaacatggtatcaagagcttgttttgatcc |
24131973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University