View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4140_low_15 (Length: 235)
Name: NF4140_low_15
Description: NF4140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4140_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 122 - 220
Target Start/End: Complemental strand, 31931231 - 31931133
Alignment:
| Q |
122 |
tactttcgtgttatttattttgatgtgtaagagaaaatgtggtaccttgaacccattgtggcgattactttgttaacaattttatattctatagttctt |
220 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
31931231 |
tactttcatgttgtttattttgatgtgtaagagaaaatgtggtacctttaacccattttggcgattactttgttaataattttatattttatagttctt |
31931133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University