View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4141_high_2 (Length: 249)
Name: NF4141_high_2
Description: NF4141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4141_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 247
Target Start/End: Original strand, 19792263 - 19792496
Alignment:
| Q |
19 |
tcatcacttttgtttttcaaaccctctctcccataagataataaa--gtgtgttttcaatctccaaaatggagaagaaaactatgttctcttttgcactc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19792263 |
tcatcacttttgtttttcaaaccctctctgccataaaataataaaaagtgtgttttcaatctccaaaatggagaagaaaactatgttctcttttgcactc |
19792362 |
T |
|
| Q |
117 |
atctgcattgttgtcgccgccgtcaaaggccattcccctt---caacactgtccacatcacccgcgaccactctagcttcattaccggcaacacctcctt |
213 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19792363 |
atctgcattgttgtcgccgctgtcagaggccattctcctttggcaacactgtccacatcacccgcgaccactctggcttcattaccggcaacacctcctt |
19792462 |
T |
|
| Q |
214 |
ccaatcccacatcaccagccccctttgcttctcc |
247 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
19792463 |
ccaatcccacatcaccagcccctgttgcttctcc |
19792496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University