View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4141_low_6 (Length: 288)
Name: NF4141_low_6
Description: NF4141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4141_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 40 - 278
Target Start/End: Complemental strand, 6175566 - 6175328
Alignment:
| Q |
40 |
gaggaatgctttagaaaacatttgatatcatattcacatgaaagatgttgagtattctaacttttcttttttctttcatacaagtggtcattttatgtaa |
139 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6175566 |
gaggaatgttttagaaaacatttgatatcatattcacatgaaagatgttgagtattctaacttttcttttttctttcatacaagtggtcattttatgtaa |
6175467 |
T |
|
| Q |
140 |
tatacaacatgccggagataaaataggcttccatatgtgtatgtatccataaataagctgcggataaatagagcctttcaagttccatgcaaacaaaatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6175466 |
tatacaacatgccggagataaaataggcttccatatgtgtatgtatccataaataagctgcgggtaaatagagcctttcaagttccctgcaaacaaaatt |
6175367 |
T |
|
| Q |
240 |
ctttaacttaattcctttgttgttgataccttacaagtt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6175366 |
ctttaacttaattcctttgttgttgataccttacaagtt |
6175328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University