View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4141_low_8 (Length: 238)
Name: NF4141_low_8
Description: NF4141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4141_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 9 - 93
Target Start/End: Complemental strand, 30840375 - 30840291
Alignment:
| Q |
9 |
agaaaagaagggggaaaaaggatgctaatgtgtatcacatttcgggatgaaattggtggtaagtatttggggatgaaattatggt |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30840375 |
agaaaagaagggggaaaaaggatgctaatgtgtatcacatttcgggattaaattggtagtaagtatttggggatgaaattatggt |
30840291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 132 - 195
Target Start/End: Complemental strand, 30840291 - 30840230
Alignment:
| Q |
132 |
taatgtacaaagtcatttttataattgaattaataaattttgctattaatgtgtgcatgatgta |
195 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30840291 |
taatgtacaaagtcattttta--attgaattaataaattttactattaatgtgtgcatgatgta |
30840230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University