View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4141_low_8 (Length: 238)

Name: NF4141_low_8
Description: NF4141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4141_low_8
NF4141_low_8
[»] chr3 (2 HSPs)
chr3 (9-93)||(30840291-30840375)
chr3 (132-195)||(30840230-30840291)


Alignment Details
Target: chr3 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 9 - 93
Target Start/End: Complemental strand, 30840375 - 30840291
Alignment:
9 agaaaagaagggggaaaaaggatgctaatgtgtatcacatttcgggatgaaattggtggtaagtatttggggatgaaattatggt 93  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||    
30840375 agaaaagaagggggaaaaaggatgctaatgtgtatcacatttcgggattaaattggtagtaagtatttggggatgaaattatggt 30840291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 132 - 195
Target Start/End: Complemental strand, 30840291 - 30840230
Alignment:
132 taatgtacaaagtcatttttataattgaattaataaattttgctattaatgtgtgcatgatgta 195  Q
    |||||||||||||||||||||  |||||||||||||||||| ||||||||||||||||||||||    
30840291 taatgtacaaagtcattttta--attgaattaataaattttactattaatgtgtgcatgatgta 30840230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University