View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4142_high_16 (Length: 319)
Name: NF4142_high_16
Description: NF4142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4142_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 19 - 141
Target Start/End: Complemental strand, 7743078 - 7742956
Alignment:
| Q |
19 |
ctttgggtctctaacagatggcaaaagtgattgttgttctacatctgtagtttcttcatcatattcttcagccaaccgctgctttccatatctctcatgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7743078 |
ctttgggtctctaacagatggcaaaagtgattgttgttctacatctgtagtttcttcatcatattcttcagccaaccgctgctttccatatctctcatgt |
7742979 |
T |
 |
| Q |
119 |
atccttctttccatctcttcaag |
141 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7742978 |
atccttctttccatctcttcaag |
7742956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 134 - 253
Target Start/End: Complemental strand, 7742727 - 7742611
Alignment:
| Q |
134 |
tcttcaaggtcttcatgatcttcttggtgtggtggctggtgatggtgatgtgctctccctctattagtattatcatcttcgtcttgcacatcaggaccga |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7742727 |
tcttcaaggtcttcatgatcttcttggtgtggtggctggtgatggtgatgcgctctccctctattagtattatcatcttcgtcttgcacatc---accga |
7742631 |
T |
 |
| Q |
234 |
taatgaagcctgcatgcatg |
253 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7742630 |
taatgaagcctgcatgcatg |
7742611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 19 - 249
Target Start/End: Complemental strand, 40864618 - 40864400
Alignment:
| Q |
19 |
ctttgggtctctaacagatggcaaaagtgattgttgttctacatctgtagtttcttcatcatattcttcagccaaccgctgctttccatatctctcatgt |
118 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||| |||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
40864618 |
ctttgggtctctcacagatggcaaaagtgcttgctgttctacatctgtagtttcttcatcgtattct---gccaaccgctgctttccatatctctcttgt |
40864522 |
T |
 |
| Q |
119 |
atccttctttccatctcttcaaggtcttcatgatcttcttggtgtggtggctggtgatggtgatgtgctctccctctattagtattatcatcttcgtctt |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |||||| || |||| ||| || |||| |||||||||||||||||| |
|
|
| T |
40864521 |
atccttcttgccatctcttcaaggtcttcatgatcttcttggtggggtggc---tgtctgtgacgtggccttcctc------tattatcatcttcgtctt |
40864431 |
T |
 |
| Q |
219 |
gcacatcaggaccgataatgaagcctgcatg |
249 |
Q |
| |
|
|||||||||| || | ||||||||||||||| |
|
|
| T |
40864430 |
gcacatcaggcccaacaatgaagcctgcatg |
40864400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University