View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4142_high_30 (Length: 250)
Name: NF4142_high_30
Description: NF4142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4142_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 48254997 - 48254801
Alignment:
| Q |
1 |
ttaattgttgctcagaaaccaaacttccatcaccagatatacttggaaaatctttgtatacattttatattggccaaaatgatttcacttccaacctagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48254997 |
ttaattgttgctcagaaaccaaacttccatcaccagatatacttggaaaatctttgtatacattttatattggccaaaatgatttcacttccaacctagc |
48254898 |
T |
 |
| Q |
101 |
agtcattggcacaggtggtgtgcaagagtttctccctcaagttgtttcacaaattgccgctaccattaaagtaagagtaacttatgtctattagtta |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48254897 |
agtcattggcacaggtggtgtgcaagagtttctccctcaagttgtttcacaaattgccgctaccattaaagtaagagtaacttatgtctattagtta |
48254801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 80 - 192
Target Start/End: Original strand, 39282245 - 39282357
Alignment:
| Q |
80 |
tgatttcacttccaacctagcagtcattggcacaggtggtgtgcaagagtttctccctcaagttgtttcacaaattgccgctaccattaaagtaagagta |
179 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| |||| | ||||| |||| ||| | || |||| ||||||| ||||| || |||||||| ||||| || |
|
|
| T |
39282245 |
tgatttcacttccaacgtagcagtcatcggcataggtagagtgcacgagtatctgcttctagttatttcacagattgctgccaccattaaggtaaggata |
39282344 |
T |
 |
| Q |
180 |
acttatgtctatt |
192 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
39282345 |
ccttatgactatt |
39282357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University