View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4142_high_39 (Length: 238)
Name: NF4142_high_39
Description: NF4142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4142_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 17 - 105
Target Start/End: Complemental strand, 55980862 - 55980774
Alignment:
| Q |
17 |
agtaatcaggtctccaaatgaatgtataaatataataagataccttcttccaaattccaaatgtaataccatacattaactattctatc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55980862 |
agtaatcaggtctccaaatgaatgtataaatataataagataccttcttccaaattcaaaatgtaataccatacattaactattctatc |
55980774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 169 - 238
Target Start/End: Complemental strand, 55980722 - 55980653
Alignment:
| Q |
169 |
aactgttgaatttcttagtagagaaaaacacccggttgatttctacctattgaaccattcatctttttct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55980722 |
aactgttgaatttcttagtagagaaaaacaaccggttgatttctacctattgaaccattcatctttttct |
55980653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University