View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4142_low_15 (Length: 325)
Name: NF4142_low_15
Description: NF4142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4142_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 18 - 319
Target Start/End: Original strand, 437712 - 438016
Alignment:
| Q |
18 |
aagttcatccttcaagctccacatgctactgcgaaatcaaactcaaaggcgttgattctcc---accttgccacgttgcaacagttcctctaatatctga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
437712 |
aagttcatccttcaagctccacatgctactgcgaaatcaaactcaaaggcgttgattctcctccacctttccacgttgcaacagttcctctaatatctga |
437811 |
T |
|
| Q |
115 |
atcagaaacacaccctcactctctcgctgctacctttgatttcccaaaatcacaaatctctaactttaaaaaccctctcatcaaaatctccgttttcaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
437812 |
atcagaaacacaccctcactctctcgctgctacctttgatttcccaaaatcacaaatctctaactttaaaaaccctctcatcaaaatctccgttttcaaa |
437911 |
T |
|
| Q |
215 |
actaacacaaacccttcatgcgttttcaacactgcaaaactcgtaggtcaaatttcaataccccttgatctaacgttagttgaatcacgaccttgttctt |
314 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
437912 |
acgaacacaaacccttcatgcgttttcaacactgcaaaactcgtaggtcaaatttcaataccccttgatctaacgttagttgaatcacgaccttgttctt |
438011 |
T |
|
| Q |
315 |
ctcac |
319 |
Q |
| |
|
|||| |
|
|
| T |
438012 |
ttcac |
438016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University