View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4142_low_21 (Length: 284)
Name: NF4142_low_21
Description: NF4142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4142_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 7 - 172
Target Start/End: Original strand, 34541078 - 34541243
Alignment:
| Q |
7 |
gtgagatgaaagctatagaaatattgtttaagcagaaatggctacggctgtcaaatatataaacacagataaatggcaaaattcctaaaataaatcttgc |
106 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34541078 |
gtgacatgaaagcaatagaaatattgtttaagcagaaatggatacggctgtcaaatatataagcacagataaatggcaaaattcctaaaacaaatcttgc |
34541177 |
T |
|
| Q |
107 |
ttaacagttacgcttatgttcttcttcttctttggattacagctacactttgtttagtttaggcac |
172 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34541178 |
ttaacagttacgcttatgtttttcttcttctttggattacagctacactttgtttagtttaggcac |
34541243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 237 - 268
Target Start/End: Original strand, 34541308 - 34541339
Alignment:
| Q |
237 |
gttaagaatcgtacacaaaacacctataaaat |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34541308 |
gttaagaatcgtacacaaaacacctataaaat |
34541339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University