View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4142_low_26 (Length: 270)
Name: NF4142_low_26
Description: NF4142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4142_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 9e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 39 - 138
Target Start/End: Complemental strand, 13504158 - 13504057
Alignment:
| Q |
39 |
tcaacacatattttcgtaattatagcggttcatgccccgtgtgaaaatcaatggaataacta--acgaccatataactataaggtaattatacattcttg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13504158 |
tcaacacatattttcgtaattatagcggttcatgtcccgtgtgaaaatcaatggaataactaacacgaccatataactataaggtaattatacattcttg |
13504059 |
T |
|
| Q |
137 |
tc |
138 |
Q |
| |
|
|| |
|
|
| T |
13504058 |
tc |
13504057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 198 - 265
Target Start/End: Complemental strand, 13503997 - 13503930
Alignment:
| Q |
198 |
gtctcgtattaatgattgaaaagtgcctctcacactataaagcaaccccttccataatcccaattcat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13503997 |
gtctcgtattaatgattgaaaagtgcctctcacactataaagcaaccccttccataatcccaattcat |
13503930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University