View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4142_low_27 (Length: 265)
Name: NF4142_low_27
Description: NF4142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4142_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 108 - 246
Target Start/End: Complemental strand, 51192301 - 51192163
Alignment:
| Q |
108 |
caatttatttcattgaaaaatgataatataaaataaaatatgttaagacaaatacaacgaccaggtcttacttcaccaagtgagatgactacatgaatca |
207 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51192301 |
caatttatttcattaaaaaatgataatataaaataaaatatgttaagacaaatacaacaaccaggtcttacttcactaagtgagatgactacatgaatca |
51192202 |
T |
|
| Q |
208 |
aacaatatcattgtgatttataaaagcgtgtctttctct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51192201 |
aacaatatcattgtgatttataaaagcgtgtctttctct |
51192163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 11 - 84
Target Start/End: Complemental strand, 51210475 - 51210402
Alignment:
| Q |
11 |
cacagaactgtgataagatcggcaaatcacctgatatttcccaaatgcaaccatcaggtgctttaatattattt |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51210475 |
cacagaactgtgataagatcggcaaatcacctgatatttcccaaatgcaaccatcaggtgctttaatattattt |
51210402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University