View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4142_low_28 (Length: 263)
Name: NF4142_low_28
Description: NF4142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4142_low_28 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 11 - 263
Target Start/End: Original strand, 23177653 - 23177905
Alignment:
| Q |
11 |
cacagatacccttttgcctggaatgaacataggctacgatactgacataggacacacttggtcattgagatcatggaagagtacagacgacccctcttca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23177653 |
cacagatacccttttgcctggaatgaacataggctacgatactgacacaggacacacttggtcattgagatcatggaagagtacagacgacccctcttca |
23177752 |
T |
 |
| Q |
111 |
ggaccatatacccttcaatatgattctcgctctgcgaatctgtctgttagtaaaggttcaaatgttttgtggattgacggtagttccaatttttcttttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23177753 |
ggaccatatacccttcaatatgattctcgctctgcgaatctgtctgttagtaaaggttcaaatgttttgtggattgacggtaattccaatttttcttttc |
23177852 |
T |
 |
| Q |
211 |
atgatgttttgaaccgagcggagttcaaacagagctacggcttgaacaactat |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23177853 |
atgatgttttgaaccgagcggagttcaaacagagctacggcttgaacaactat |
23177905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 15 - 185
Target Start/End: Original strand, 23186786 - 23186956
Alignment:
| Q |
15 |
gatacccttttgcctggaatgaacataggctacgatactgacataggacacacttggtcattgagatcatggaagagtacagacgacccctcttcaggac |
114 |
Q |
| |
|
||||||||||| |||||||||| | |||| |||||||| ||| ||||| |||||||||||||||||||||||| |||||||||||||||| | |||| |
|
|
| T |
23186786 |
gatacccttttacctggaatgaccttaggacacgatacttacacaggacgtacttggtcattgagatcatggaagcgtacagacgacccctccacgggac |
23186885 |
T |
 |
| Q |
115 |
catatacccttcaatatgattctcgctctgcgaatctgtctgttagtaaaggttcaaatgttttgtggatt |
185 |
Q |
| |
|
||| ||| || | ||||||||| ||| || | |||| |||| |||||| |||||||||||| | |||||| |
|
|
| T |
23186886 |
catttactctgcgctatgattctggctttgggtatctatctgatagtaatggttcaaatgttgtatggatt |
23186956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 87
Target Start/End: Complemental strand, 21182304 - 21182232
Alignment:
| Q |
15 |
gatacccttttgcctggaatgaacataggctacgatactgacataggacacacttggtcattgagatcatgga |
87 |
Q |
| |
|
||||||||||| |||||||||||||| || |||||| | ||| ||| |||||| ||| ||||||||||||| |
|
|
| T |
21182304 |
gatacccttttacctggaatgaacatcggacacgatattaacacagggtacactttgtctttgagatcatgga |
21182232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University