View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4142_low_32 (Length: 250)
Name: NF4142_low_32
Description: NF4142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4142_low_32 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 162 - 220
Target Start/End: Complemental strand, 1459274 - 1459216
Alignment:
| Q |
162 |
ctaaagcagcatcgggatcaattcgggatgttttttcttgcaatatattgcgttgctgt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
1459274 |
ctaaagcagcatcgggatcaattcgggatgttttttctcgcaatatattgcattgctgt |
1459216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 90 - 123
Target Start/End: Original strand, 13713632 - 13713665
Alignment:
| Q |
90 |
ggctggtcaacacattgaccatcatgttttccac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
13713632 |
ggctggtcaacacattgaccatcatgttttccac |
13713665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 222 - 250
Target Start/End: Complemental strand, 1052575 - 1052547
Alignment:
| Q |
222 |
tttattaagagaaatgatatttgtacaac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1052575 |
tttattaagagaaatgatatttgtacaac |
1052547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University