View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4142_low_40 (Length: 239)
Name: NF4142_low_40
Description: NF4142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4142_low_40 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 5655989 - 5655767
Alignment:
| Q |
18 |
acatggagcctcatgatcattataaaccaaaagggc--tagccaatgcacgagaacaaattttaaaaggtttggattgtaatgtaaatttcgaaacaatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5655989 |
acatggagcctcatgatcattataaaccaaaagggcactagccaatgcagaagaacaaattttaaaaggtttggattgtaatgtaaatttcgaaacaatt |
5655890 |
T |
 |
| Q |
116 |
ttgttgttttggttaattacaataatgcacaaaacagtagcaaatatatcaaggagtaaacataaagtgtttttacatagaaggaaattgagggtagtaa |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5655889 |
ttgtt-ttttggttaattacaataatgcacaaaacagtagcaaatatatcaaggagtaaacataaagtgtttttacatagaaggaaattgagggtagtaa |
5655791 |
T |
 |
| Q |
216 |
atttctgaaatcaccaattcgtac |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5655790 |
atttctgaaatcaccaattcgtac |
5655767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University