View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4142_low_47 (Length: 232)
Name: NF4142_low_47
Description: NF4142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4142_low_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 17109109 - 17109322
Alignment:
| Q |
1 |
tatgcaagtcatgaaataagttgtatataaactagttgtaaacacttttcattaatcaatgagaatcacaatttacaacaaatttgatattctc-ttctc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |||||||| ||||| |
|
|
| T |
17109109 |
tatgcaagtcatgaaataagttgtatataaactagttggaaacacttttcattaatcaatgagaatcacaattcacaacaaatttaatattctcattctc |
17109208 |
T |
|
| Q |
100 |
actatttgccaattcttnnnnnnnnnnnnnnntagaaattcaatagtttgtcgtacaagcaagtaattctgttgcgggtaacatcattgactttgttgaa |
199 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
17109209 |
actatttgtcaattctt-------tctctctctagaaattcaatagtttgtcgtacaagcaag---ttctgttg-tggtaacatcattgactttgttgaa |
17109297 |
T |
|
| Q |
200 |
gtaatttaattattttcttattgat |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
17109298 |
gtaatttaattattttcttattgat |
17109322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 10683717 - 10683654
Alignment:
| Q |
15 |
aataagttgtatataaactagttgtaaacacttttcattaatcaatgagaatcacaatttacaa |
78 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
10683717 |
aataagttgtatataagatagttgtaaacacttttcatctatcaatgacaattacaatttacaa |
10683654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University