View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4142_low_48 (Length: 227)
Name: NF4142_low_48
Description: NF4142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4142_low_48 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 8 - 136
Target Start/End: Original strand, 29010496 - 29010624
Alignment:
| Q |
8 |
atactcggttctttgcaaaatacgttcacgtccttctttcttgaatgctgctgcatctcttgtctttgttaggtaattgttttcgatgtttttcttttca |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29010496 |
atactcagttctttgcaaaatacgttcacgtcattctttcttgaatgccgctgcatctcttgtctttgttaggtaattgtttttgatgtttttcttttca |
29010595 |
T |
|
| Q |
108 |
attaccaaaattttctctatttctttgtt |
136 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29010596 |
attaccaaaattttctctatttctttgtt |
29010624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 136 - 227
Target Start/End: Original strand, 29010688 - 29010779
Alignment:
| Q |
136 |
tcaggtcattattatgttaaattaaattatgatctatttgcgcagtaaaaatgcttattcatataagttgctttaagcaagatgataaaata |
227 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29010688 |
tcaggtcattattatgttagatcaaattatgatctatttgcgcagtaaaagtgcttattcagataagttgctttaagcaagatgataaaata |
29010779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University