View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4143_high_1 (Length: 240)
Name: NF4143_high_1
Description: NF4143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4143_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 31138620 - 31138421
Alignment:
| Q |
1 |
tgattgttttcccttttattgtttattcgccactattgttctattctcatgcataggatattaggataccatattcatatgacactctagtagtctttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31138620 |
tgattgttttcccttttattgtttattcgccactattgttctattctcatgcataggatattaggatatcatattcatatgacactctagtagtctttga |
31138521 |
T |
|
| Q |
101 |
aggctagctctagtttgaatttatccgagttcatgtccaaactatgcatttaacaacattgtgttgcttatcaccaaaatatggctgatattgctcctag |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
31138520 |
aggctagctctagtgtgaatttatccgagttcatgtccaaactatgcatttaacaacattgtgttacttatcaacaaaatatggctgatattgctcctag |
31138421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 129 - 209
Target Start/End: Original strand, 31102439 - 31102519
Alignment:
| Q |
129 |
gttcatgtccaaactatgcatttaacaacattgtgttgcttatcaccaaaatatggctgatattgctcctagtcacatatt |
209 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31102439 |
gttcatgtcgaaactatgcatttaacaacattgtgttacttatcaacaaaatatggctgatattgctcctagtcacatatt |
31102519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 31102368 - 31102423
Alignment:
| Q |
1 |
tgattgttttcccttttattgtttattcgccactattgttctattctcatgcatag |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31102368 |
tgattgttttcccttttattgtttattcgccactattgttctattctcatgcatag |
31102423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University