View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4143_low_2 (Length: 230)
Name: NF4143_low_2
Description: NF4143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4143_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 12 - 213
Target Start/End: Original strand, 47826498 - 47826699
Alignment:
| Q |
12 |
agaagaagagatggcaaagataacgggcaaagaagctgctctttttgtcccatcaggcactatggggaacctcatatctgtgcttgttcattgtgacata |
111 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47826498 |
agaagaagagatggcaaagataacgggaaaagaagctgctctttttgtcccatcaggcactatggggaacctcatatctgtgcttgttcattgtgacata |
47826597 |
T |
|
| Q |
112 |
agagggagtgaagttattcttggagacaattcacatattcatatttatgagaatggaggcattgcaacccttggaggtgtacatccaagaacagttagaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47826598 |
agagggagtgaagttattcttggagacaattcacatattcatatttatgagaatggaggcattgcaacccttggaggtgtacatccaagaacagttagaa |
47826697 |
T |
|
| Q |
212 |
at |
213 |
Q |
| |
|
|| |
|
|
| T |
47826698 |
at |
47826699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 35630701 - 35630522
Alignment:
| Q |
18 |
agagatggcaaagataacgggcaaagaagctgctctttttgtcccatcaggcactatggggaacctcatatctgtgcttgttcattgtgacataagaggg |
117 |
Q |
| |
|
||||||||||||||| | ||| || ||||| ||||||||||| |||||||| |||||||||||||| || | ||| |||||||||||||| || || ||| |
|
|
| T |
35630701 |
agagatggcaaagatgatgggaaaggaagcagctctttttgttccatcagggactatggggaaccttatttgtgttcttgttcattgtgatattaggggg |
35630602 |
T |
|
| Q |
118 |
agtgaagttattcttggagacaattcacatattcatatttatgagaatggaggcattgcaacccttggaggtgtacatcc |
197 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||| || ||| |||| | || ||||||||||| |
|
|
| T |
35630601 |
agtgaagttattcttggagacaattgccatatcaatatttatgagaatggtggtatttcaactatcggcggtgtacatcc |
35630522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University