View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4144_low_3 (Length: 268)
Name: NF4144_low_3
Description: NF4144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4144_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 18 - 256
Target Start/End: Complemental strand, 32914979 - 32914741
Alignment:
| Q |
18 |
attatgataatgatgagataactaaccattgtgttgctagtggaaaagtgtcacatgtggtttatggtctctagcgatctatgaagcacatgtatgtaat |
117 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
32914979 |
attatgataatgattagataactagccattgtgttgctagtggaaaagtgttacatgtggtttattgtctctagcgatctatgaagcacatgtatctaat |
32914880 |
T |
|
| Q |
118 |
cctcggattaggcgtgtttagatgtcagatatgtaacatatctgacaccaatacatgattccaataaatcatgtcagttttttaataatgtcattttnnn |
217 |
Q |
| |
|
| |||||| ||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32914879 |
cttcggatcaggcgtgtttagatgtcagatatgtaacatatccgacaccaacacatgattccaataaatcatgtcagttttttaataatgtcatttttta |
32914780 |
T |
|
| Q |
218 |
nnnnntattttccgtgttaaattatttgtgtcgtgtctg |
256 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||| |
|
|
| T |
32914779 |
aaaattattttctgtgtcaaattatttgtgtcgtgtctg |
32914741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 117 - 173
Target Start/End: Complemental strand, 17155597 - 17155541
Alignment:
| Q |
117 |
tcctcggattaggcgtgtttagatgtcagatatgtaacatatctgacaccaatacat |
173 |
Q |
| |
|
|||||| ||||| |||||| |||||| |||||||| ||||||||||||| |||||| |
|
|
| T |
17155597 |
tcctcgtattagatgtgttttgatgtcggatatgtatcatatctgacaccgatacat |
17155541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University