View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4144_low_4 (Length: 247)
Name: NF4144_low_4
Description: NF4144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4144_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 15381996 - 15381766
Alignment:
| Q |
1 |
aatgtaataaaggcatgttcagctgcataggtagtggttgctacccatcttccatttcattatgaaacatttatttgacaagatgtgtctctgatgtaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| ||||||| ||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15381996 |
aatgtaataaaggcatgttcagctgcataggtagtagttgctacccttcttccaattcattatggaacatttatttgacaagatgtatctctgatgtaaa |
15381897 |
T |
|
| Q |
101 |
agttgaaatgtttgggtggtcaaaatatgaaaataaatgttcctcatatgaagatctatgtctgaatgaatgaatagatgaatgcaaagcagagactgtc |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15381896 |
agttgaaatgtttgggtggtcaaaacatgaaaataaatgttccacatatgaagatctatgtctgaatgaatgaatagatgaatgcaaagcagagactgtc |
15381797 |
T |
|
| Q |
201 |
ggaaatttcagggggcaagtgatgtagtata |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15381796 |
ggaaatttcagggggcaagtgatgtagtata |
15381766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University