View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4146_low_1 (Length: 348)
Name: NF4146_low_1
Description: NF4146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4146_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 19 - 338
Target Start/End: Complemental strand, 39930448 - 39930129
Alignment:
| Q |
19 |
atcagaccttagaacaagtgcacattggggattatatttgtattaaggttcgtgttagacacgaactatgtgtcaatcccccacaatatccttctttaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39930448 |
atcagaccttagaacaagtgcacattggggattatatttgtattaaggttcgtgttagacacgaactatgtgtcaatcccccaaaatatccttctttaat |
39930349 |
T |
|
| Q |
119 |
attaccatttgattgggttttttatgcgcaaaccatgtttgtaccttatcatgaatttcatcaaaatagtctattatacatgcaaacttatttttctaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39930348 |
attaccatttgattgggttttttatgcgcaaaccatgtttgtaccttatcatgaatttcatcaaaatagtctattatacatgcaaacttatttttctaat |
39930249 |
T |
|
| Q |
219 |
gctatcatcccatatgatgcgatgtactcatgcatgccacatgtaatgacatatattgataatgtacgaaactcttaccccaatcctcattatgaaagtc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39930248 |
gctatcatcccatatgatgcgatgtactcatgcatgccacatgtaatgacatatattgataatgtacgaaactcttaccccaatcctcattatgaaagtc |
39930149 |
T |
|
| Q |
319 |
cccgaattcgtgtgctccct |
338 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
39930148 |
cccgaattcgtgtgctccct |
39930129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University