View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4147_high_16 (Length: 322)
Name: NF4147_high_16
Description: NF4147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4147_high_16 |
 | |
|
| [»] scaffold0012 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0012 (Bit Score: 124; Significance: 9e-64; HSPs: 2)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 139 - 278
Target Start/End: Original strand, 151796 - 151935
Alignment:
| Q |
139 |
attcggattcggcagaagaacatgatttttgttctgaaggtaacattttcagattctctcccacaacgtaaccactgcgatatctttttgtttttcggaa |
238 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
151796 |
attcggattgagcaaaagaacatgatttttgttctgaaggtaacattttcagattctctcccacaacgtaaccactgcgatatctttttgttttttggaa |
151895 |
T |
|
| Q |
239 |
gcaagtatcagatcttgctactcgccaattctagttattc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
151896 |
gcaagtatcagatcttgctactcgccaattctagttattc |
151935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 18 - 134
Target Start/End: Original strand, 151567 - 151682
Alignment:
| Q |
18 |
catcaaaggtgatgacaataaataggcctaacttgatcattttcttgagaggnnnnnnnngttcgcaatctttttcaatattgtgtttaatatgaaacct |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
151567 |
catcaaaggtgatgacaataaataggc-taacttgatcattttcttgtgaggaaagaaaagttcgcaatctttttcaatattgtgtttaatatgaaacct |
151665 |
T |
|
| Q |
118 |
cgtgagtatctatatat |
134 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
151666 |
cgtgagtatctatatat |
151682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 139 - 199
Target Start/End: Original strand, 34506569 - 34506629
Alignment:
| Q |
139 |
attcggattcggcagaagaacatgatttttgttctgaaggtaacattttcagattctctcc |
199 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
34506569 |
attcggattgggcagaagaacatgattcttgttctgaagataccattttcagattctctcc |
34506629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 78 - 121
Target Start/End: Original strand, 34506388 - 34506431
Alignment:
| Q |
78 |
gttcgcaatctttttcaatattgtgtttaatatgaaacctcgtg |
121 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
34506388 |
gttcgcaatctttttcaatatgttgtttaatatgaaatctcgtg |
34506431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 208 - 278
Target Start/End: Original strand, 34506666 - 34506737
Alignment:
| Q |
208 |
aaccactgcgatatctttt-tgtttttcggaagcaagtatcagatcttgctactcgccaattctagttattc |
278 |
Q |
| |
|
|||||||| |||||||||| ||| | | ||||||||||| ||||| ||||||| | |||||||||||||||| |
|
|
| T |
34506666 |
aaccactgtgatatcttttatgtatcttggaagcaagtaccagatattgctacacaccaattctagttattc |
34506737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University