View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4147_high_24 (Length: 248)
Name: NF4147_high_24
Description: NF4147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4147_high_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 15 - 237
Target Start/End: Original strand, 40965902 - 40966127
Alignment:
| Q |
15 |
catatgttacccgcaattctttatttcttactatttagtgtgtattagtttcgcatttaggctatttat---gaaagaaaataaaatcaattttgttgag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40965902 |
catatgttacccgcaattctttatttcttactatttagtgtgtattagtttcgcatttaggctatttattatgaaagaaaataaaatcaattttgttgag |
40966001 |
T |
|
| Q |
112 |
gaatgtgactttggttgtttttgaaggcaggtgatggcggtgcgggtggtggaatttcccttgccggaacatggtgggataaaaaagcattagcaattgc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40966002 |
gaatgtgactttggttgtttttgaaggcaggtgatggcggtgcgggtggtggaatttcccttgccggaacatggtgggataaaaaagcattagcaattgc |
40966101 |
T |
|
| Q |
212 |
taaagaggttactatgtcttttgatg |
237 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40966102 |
taaagaggttactatgtcttttgatg |
40966127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University