View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4147_low_16 (Length: 327)
Name: NF4147_low_16
Description: NF4147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4147_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 321
Target Start/End: Complemental strand, 3759136 - 3758819
Alignment:
| Q |
1 |
tcttcattttgattgatacacaaatcctttaataaaactaaatcgtcnnnnnnnnnnnnnnnnnngttacggctatggtactcattcaaaaactttctag |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3759136 |
tcttcattttgattaatacacaaatcctttaataaaactaaatcgtccttcttcttcttctt---gttacggctatggtactcattcaaaaactttctag |
3759040 |
T |
|
| Q |
101 |
tagcttcctccaccttagccctaccctcttccaccccacaaaaacgtaccgttttgtaatcatttctaccacaaaatgacgcggttttgctcaaacaaga |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3759039 |
tagcttcctccaccttagctctaccctcttccactccacaaaaaccaacagttttgtaatcatttctaccacaaaatgacgctgttttgctcaaacaaga |
3758940 |
T |
|
| Q |
201 |
ccgtgaaaatgaagaagcagatgaacacgtggaagctacttttccctcatgagtctcccacgtgttcatttgcttcttcgtctttgttggtttctcagtc |
300 |
Q |
| |
|
||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3758939 |
ccgcgaaaacgaagaagcagatgaacacgtggaagctacttttccctcatgagtctcccacgtgttcatctgcttcttcgtctttgttggtttctcagtc |
3758840 |
T |
|
| Q |
301 |
ttcgttttcttctcattgtta |
321 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
3758839 |
ttcattttcttctcattgtta |
3758819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University