View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4147_low_22 (Length: 288)
Name: NF4147_low_22
Description: NF4147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4147_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 5789712 - 5789601
Alignment:
| Q |
1 |
ttgttcttgttcttgttccatccttcataaactgtttctgagttcaatatcaactttttcttcttctactttgttcattctctctcactattcactactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5789712 |
ttgttcttgttcttgttccatccttcataaactgtttctgagttcaatatcaactttttcttcttctactttgttcattctctctcactattcactactg |
5789613 |
T |
 |
| Q |
101 |
tgagctaaatag |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5789612 |
tgagctaaatag |
5789601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 160 - 272
Target Start/End: Complemental strand, 5789553 - 5789441
Alignment:
| Q |
160 |
agatccaaaaaacattaccaacatataaaaaacacaagatctatatggtctataagacaacacaaaacaaaataaccttagttttctaaaacaaaacctt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5789553 |
agatccaaaaaacattaccaacatataaaaaacacaagatctatatggtctataagacaacataaaacaaaacaaccttagttttctaaaacaaaacctt |
5789454 |
T |
 |
| Q |
260 |
gacttgcaaacat |
272 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5789453 |
gacttgcaaacat |
5789441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University