View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4147_low_28 (Length: 241)
Name: NF4147_low_28
Description: NF4147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4147_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 9 - 105
Target Start/End: Complemental strand, 5736310 - 5736214
Alignment:
| Q |
9 |
gaacctgtgcatctctcagggaatttctacttgccatgttaattgtggtgaagtgtgggaaacaacaactataccaagaaaatagagaacactcctt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5736310 |
gaacctgtgcatctctcagggaatttctacttgccatgttaattgtggtgaagtgtgggaaacaacaactataccaagaaaatagagaatactcctt |
5736214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 9 - 105
Target Start/End: Complemental strand, 5773422 - 5773326
Alignment:
| Q |
9 |
gaacctgtgcatctctcagggaatttctacttgccatgttaattgtggtgaagtgtgggaaacaacaactataccaagaaaatagagaacactcctt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5773422 |
gaacctgtgcatctctcagggaatttctacttgccatgttaattgtggtgaagtgtgggaaacaacaactataccaagaaaatagagaatactcctt |
5773326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 9 - 132
Target Start/End: Complemental strand, 5697660 - 5697524
Alignment:
| Q |
9 |
gaacctgtgcatctctcagggaatttct---acttgccatgttaattgtggtgaagtgtgggaaacaacaactataccaagaaaatagagaa-------- |
97 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
5697660 |
gaacctgtgaatctctcagggaatttcttctacttgccatgttaattgtggtaaagtgtgggaaacaacaattataccaagaaattagagaaaaatacag |
5697561 |
T |
 |
| Q |
98 |
--cactccttttgttgcttaagatattctcttaatat |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5697560 |
attactccttttgttgcttaagatattctcttaatat |
5697524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 5671810 - 5671746
Alignment:
| Q |
163 |
tctggttggatatagaccagttgatggcacatccatcttttatccagtctctcccatttcattac |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5671810 |
tctggttggatatagaccagttgatggcacatccatcttttatccagtctcttccatttcattac |
5671746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 159 - 224
Target Start/End: Complemental strand, 5796197 - 5796132
Alignment:
| Q |
159 |
agtctctggttggatatagaccagttgatggcacatccatcttttatccagtctctcccatttcat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
5796197 |
agtctctggttggatatagaccagttgatgacacatccatcttttatccagtctctcccgtttcat |
5796132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 5681307 - 5681243
Alignment:
| Q |
163 |
tctggttggatatagaccagttgatggcacatccatcttttatccagtctctcccatttcattac |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
5681307 |
tctggttggatatagaccagttgatggcacattcatcttttatccagtctcttccatttcattac |
5681243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 9 - 76
Target Start/End: Original strand, 41482134 - 41482203
Alignment:
| Q |
9 |
gaacctgtgcatctctcaggga--atttctacttgccatgttaattgtggtgaagtgtgggaaacaacaa |
76 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
41482134 |
gaacctgtgcatctctcaggggggatttctacttgctatgtttattgtggtgaagtgtgggaaacaacaa |
41482203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 9 - 76
Target Start/End: Original strand, 41485400 - 41485469
Alignment:
| Q |
9 |
gaacctgtgcatctctcaggga--atttctacttgccatgttaattgtggtgaagtgtgggaaacaacaa |
76 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
41485400 |
gaacctgtgcatctctcaggggggatttctacttgctatgtttattatggtgaagtgttggaaacaacaa |
41485469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 9 - 72
Target Start/End: Complemental strand, 45385716 - 45385654
Alignment:
| Q |
9 |
gaacctgtgcatctctcagggaatttctacttgccatgttaattgtggtgaagtgtgggaaaca |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||| ||||||| ||||||||||| |
|
|
| T |
45385716 |
gaacctgtgcatctctcagggaatttctacttgctttgtt-attctggtgaaatgtgggaaaca |
45385654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 216
Target Start/End: Complemental strand, 45384980 - 45384923
Alignment:
| Q |
159 |
agtctctggttggatatagaccagttgatggcacatccatcttttatccagtctctcc |
216 |
Q |
| |
|
||||| |||||||||||||||| |||||||| ||||||||| | |||||||||||| |
|
|
| T |
45384980 |
agtctatggttggatatagaccggttgatggtgcatccatctctcttccagtctctcc |
45384923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University