View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4147_low_29 (Length: 239)
Name: NF4147_low_29
Description: NF4147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4147_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 23 - 233
Target Start/End: Complemental strand, 31819748 - 31819538
Alignment:
| Q |
23 |
tgagtcatcatgaattatgatttacatagattacattatgaagtttcaacgaaaccatgatatatacattgtaattttagcaaacccgctataaccctaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31819748 |
tgagtcatcatgaattatgatttacatagattacatcatgaagtttcaacgaaaccatgatatatacattgtaattttagcaaacccgctataaccctaa |
31819649 |
T |
 |
| Q |
123 |
ttctaagcatgcactaaaaagtatatatactaggatgtttaacagcatgtatgattcttaataagcattttcttttagacatattagagtttaagaagag |
222 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31819648 |
ttttaagcatgcactaaaaagtatatatactaggatgtttaacagcatgtatgattcttaataagcattttcttttagacatattagagtttaagaagag |
31819549 |
T |
 |
| Q |
223 |
ttcatctcact |
233 |
Q |
| |
|
||||||||||| |
|
|
| T |
31819548 |
ttcatctcact |
31819538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University