View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4147_low_35 (Length: 222)
Name: NF4147_low_35
Description: NF4147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4147_low_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 30343439 - 30343234
Alignment:
| Q |
1 |
gaccttggaaaaggtttaggttgtgtggttcaaacaagagatggaggctacttagcatctatgaatcctttagacaattatgtagctcgaaacgatactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30343439 |
gaccttggaaaaggtttaggttgtgtggttcaaacaagagatggaggctacttagcatctatgaatcctttagacaattatgtagctcgaaacgatactc |
30343340 |
T |
|
| Q |
101 |
caaagctagcaatgcaaatgtcaaagccttttgtgttaacatcacaagacaccttaaatggattagagttgtttcagaaactggctgcaattgatcttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30343339 |
caaagctagcaatgcaaatgtcaaagccttttgtgttaacatcacaagacaccttaaatggattagagttgtttcagaaactggctgcaattgatcttga |
30343240 |
T |
|
| Q |
201 |
tgaact |
206 |
Q |
| |
|
|||||| |
|
|
| T |
30343239 |
tgaact |
30343234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 45029218 - 45029425
Alignment:
| Q |
1 |
gaccttggaaaaggtttaggttgtgtggttcaaacaagagatggaggctacttagcatctatgaatcctttagacaattatgtagctcgaaacgatactc |
100 |
Q |
| |
|
||||| || ||||| || |||||||||||||||||||||||||| || ||||| || || ||||||||||| || | ||| ||| |||| ||||| | |
|
|
| T |
45029218 |
gacctcggtaaaggcttgggttgtgtggttcaaacaagagatggcggatacttggcttccatgaatcctttggatgttgttgtggctagaaaagataccc |
45029317 |
T |
|
| Q |
101 |
caaagctagcaatgcaaatgtcaaagccttttgtgttaacatcacaagacaccttaaatggattagagttgtttcagaaactggctgcaattgatcttga |
200 |
Q |
| |
|
| |||||||||||||| |||||||||||||||||||| ||||||| || || ||| ||| || || |||||||||||| |||||| |||| |||||| |
|
|
| T |
45029318 |
ctaagctagcaatgcagatgtcaaagccttttgtgttggcatcacatgaatccgtaagtgggtttgacttgtttcagaaattggctggcattggtcttga |
45029417 |
T |
|
| Q |
201 |
tgaacttg |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
45029418 |
tgaacttg |
45029425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University