View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4148_high_25 (Length: 244)
Name: NF4148_high_25
Description: NF4148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4148_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 77 - 165
Target Start/End: Original strand, 26793825 - 26793913
Alignment:
| Q |
77 |
ctgctcactttattgacggttgggagacggttcgtctgagttgggaagatcggatctgcagtcgtgaagatcagattgccttcatgatg |
165 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26793825 |
ctgctcactttattgacggttaggagatggttcgtctgagttgggaagatcggatctgcagtcgtgaagatgagattgccttcatgatg |
26793913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 26793715 - 26793770
Alignment:
| Q |
1 |
caaagtagccatgtgaaaataaatgaatacgtgctctttggactagtcttcactct |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26793715 |
caaagtagccatgtgaaaataaatgaatacatgctctttggactagtcttcactct |
26793770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University