View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4148_high_25 (Length: 244)

Name: NF4148_high_25
Description: NF4148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4148_high_25
NF4148_high_25
[»] chr8 (2 HSPs)
chr8 (77-165)||(26793825-26793913)
chr8 (1-56)||(26793715-26793770)


Alignment Details
Target: chr8 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 77 - 165
Target Start/End: Original strand, 26793825 - 26793913
Alignment:
77 ctgctcactttattgacggttgggagacggttcgtctgagttgggaagatcggatctgcagtcgtgaagatcagattgccttcatgatg 165  Q
    ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
26793825 ctgctcactttattgacggttaggagatggttcgtctgagttgggaagatcggatctgcagtcgtgaagatgagattgccttcatgatg 26793913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 26793715 - 26793770
Alignment:
1 caaagtagccatgtgaaaataaatgaatacgtgctctttggactagtcttcactct 56  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
26793715 caaagtagccatgtgaaaataaatgaatacatgctctttggactagtcttcactct 26793770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University