View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4148_high_3 (Length: 516)
Name: NF4148_high_3
Description: NF4148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4148_high_3 |
 |  |
|
| [»] scaffold1429 (1 HSPs) |
 |  |  |
|
| [»] scaffold0352 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1429 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: scaffold1429
Description:
Target: scaffold1429; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 22 - 366
Target Start/End: Complemental strand, 1582 - 1238
Alignment:
| Q |
22 |
ggggggaccaaaccaaaaccccttaactaggaacaaacctaaaattaggccaacctagcttatcctttacaaaagatgcatttatacaagctggcacctc |
121 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1582 |
ggggggacccaaccaaaaccccttaactaggaacaaacctaaaattaggccaacctaacttatcctttacaaaagatgcatttatataagctggcacctc |
1483 |
T |
 |
| Q |
122 |
taaccaaatagtaagatgatcaagattatgactaaggtttgcaagtgagtctgcacactgattaccttctctatagacatgtgtgatcaagaagttcatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1482 |
taaccaaatagtaagatgatcaagattatgactaaggtttgcaagtgagtctgcacactaattaccttctctatagacatgtgtgatcaagaagttcatt |
1383 |
T |
 |
| Q |
222 |
ttataggttagcgagagacagttcagccatctgtttcttaacttccaaggaactatattagggtttatgactgctttggttacgagcacagaatctgttt |
321 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||| |
|
|
| T |
1382 |
ttataggttagcgagagacagttcaaccagctgtttcttaacctccaaggaactatattagggtttatgactgctttggtgacgatcacgtaatctgttt |
1283 |
T |
 |
| Q |
322 |
ccagccataggttgttccattcatatgcatttgctagctctattg |
366 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1282 |
ccagccacaggttgttccattcatatgcgtttgctagctctattg |
1238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 98; Significance: 5e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 23 - 128
Target Start/End: Original strand, 11440043 - 11440148
Alignment:
| Q |
23 |
gggggaccaaaccaaaaccccttaactaggaacaaacctaaaattaggccaacctagcttatcctttacaaaagatgcatttatacaagctggcacctct |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11440043 |
gggggaccaaaccaaaaccccttaactaggaacaaacctaaaattaggccaacttagcttatcctttacaaaagatgcatttatacaagctgacacctct |
11440142 |
T |
 |
| Q |
123 |
aaccaa |
128 |
Q |
| |
|
|||||| |
|
|
| T |
11440143 |
aaccaa |
11440148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 360 - 427
Target Start/End: Complemental strand, 3958 - 3891
Alignment:
| Q |
360 |
tctattgccctcattacaccagatatttcagcatgaaaagcgttcccaagaccagtactttccccaaa |
427 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| || | ||| |||| |||||||||||| ||||| |
|
|
| T |
3958 |
tctattgccctcattgcacctgaaatttcagcatgtaaggagttaccaataccagtactttctccaaa |
3891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University