View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4148_high_32 (Length: 205)

Name: NF4148_high_32
Description: NF4148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4148_high_32
NF4148_high_32
[»] chr8 (1 HSPs)
chr8 (15-186)||(26793426-26793597)


Alignment Details
Target: chr8 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 26793597 - 26793426
Alignment:
15 gagatgaaagcgttcaatgcgcagacaatggaaaggaaggaaacggtcaaacacgttgattagaggtggaagttagtgcaaaactgaaacagaaggatat 114  Q
    ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26793597 gagatgaaagcattcaatgcgcagaaaatggaaaggaaggaaacggtcaaacacgttgattagaggtggaagttagtgcaaaactgaaacagaaggatat 26793498  T
115 tattagcttaataaggaaccagttatatagaggatgcttaattccttttggtggggaggtggtaatcaaaat 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26793497 tattagcttaataaggaaccagttatatagaggatgcttaattccttttggtggggaggtggtaatcaaaat 26793426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University