View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4148_high_32 (Length: 205)
Name: NF4148_high_32
Description: NF4148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4148_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 26793597 - 26793426
Alignment:
| Q |
15 |
gagatgaaagcgttcaatgcgcagacaatggaaaggaaggaaacggtcaaacacgttgattagaggtggaagttagtgcaaaactgaaacagaaggatat |
114 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26793597 |
gagatgaaagcattcaatgcgcagaaaatggaaaggaaggaaacggtcaaacacgttgattagaggtggaagttagtgcaaaactgaaacagaaggatat |
26793498 |
T |
 |
| Q |
115 |
tattagcttaataaggaaccagttatatagaggatgcttaattccttttggtggggaggtggtaatcaaaat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26793497 |
tattagcttaataaggaaccagttatatagaggatgcttaattccttttggtggggaggtggtaatcaaaat |
26793426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University